Stem-loop hsa-mir-134
Mirna Stemloop Summary
| id | hsa-mir-134 |
| Accession | MI0000474 |
| Comments | miR-134 was first identified by cloning studies in mouse [1]. Its expression was later verified in human embryonic stem cells [2]. The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [4]. |
| Database Links | hsa-mir-134 |
| Description | Homo sapiens miR-134 stem-loop |
| Gene Family | MIPF0000112;mir-134 |
| Genome Context | chr14: 101054687-101054759 [+] |
| miRna Matures Links | |
| Sequence | CAGGGUGUGUGACUGGUUGACCAGAGGGGCAUGCACUGUGUUCACCCUGUGGGCCACCUAGUCACCAACCCUC |