Stem-loop hsa-mir-124-1
Mirna Stemloop Summary
| id | hsa-mir-124-1 |
| Accession | MI0000443 |
| Comments | miR-124 was first identified by cloning studies in mouse [1]. Its expression was later verified in human embryonic stem cells [2]. The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [5]. The 5' end of the miRNA may be offset with respect to previous annotations. |
| Database Links | hsa-mir-124-1 |
| Description | Homo sapiens miR-124-1 stem-loop |
| Gene Family | MIPF0000021;mir-124 |
| Genome Context | chr8: 9903388-9903472 [-] |
| miRna Matures Links | |
| Sequence | AGGCCUCUCUCUCCGUGUUCACAGCGGACCUUGAUUUAAAUGUCCAUACAAUUAAGGCACGCGGUGAAUGCCAAGAAUGGGGCUG |