Stem-loop mmu-mir-297a-1

mmu-mir-297a-1

MI0000395

Houbaviy et al. report that the cloned sequence of miR-297 is found over 20 times in the mouse genomic sequence [1]. This sequence appears to match several low complexity repetitive regions. Confidence in which loci actually express miR-297 is low because of the low complexity nature of the sequence. The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [2]. The ends of the miRNA may be offset with respect to previous annotations.

Mus musculus miR-297a-1 stem-loop

MIPF0000204;mir-297

chr7: 10958437-10958512 [-]

AUAUGUAUGUAUGUAUGUAUGUGUGCAUGUGCAUGUGCAUGUAUGCAUAUUGCAUGUAUAUAUUAUGCAUACAUGU