Stem-loop dme-mir-92b
Mirna Stemloop Summary
| id | dme-mir-92b |
| Accession | MI0000379 |
| Comments | miR-92b was reported independently in references [1] and [2]. Computational prediction followed by northern blotting confirmed that the strand containing the predicted miR is predominantly expressed [1]. Reference [2] confirmed the ends of the excised miRNA by cloning. |
| Database Links | dme-mir-92b |
| Description | Drosophila melanogaster miR-92b stem-loop |
| Gene Family | MIPF0000013;mir-25 |
| Genome Context | chr3R: 25651398-25651497 [+] |
| miRna Matures Links | |
| Sequence | UAAAACGUCACCUGAUGUAGGCCGUGCCCAGUGCUUAUUUGUUGCAUUUUCGAAAUACAAAUUGCACUAGUCCCGGCCUGCAAUGAGUGUCGCAGUCGAC |