Stem-loop dme-mir-277
Mirna Stemloop Summary
| id | dme-mir-277 |
| Accession | MI0000360 |
| Comments | miR-277 was reported independently in references [1] and [2]. Computational prediction followed by northern blotting confirmed that the strand containing the predicted miR is predominantly expressed [1]. Reference [2] confirmed the 5' end of the excised miRNA by cloning and reported a length distribution of 21-23 nt with 23 nt the most commonly expressed. Stark et al. [3] have predicted that miR-277 controls the pathway for valine, leucine and isoleucine degradation by downregulating many of its enzymes. |
| Database Links | dme-mir-277 |
| Description | Drosophila melanogaster miR-277 stem-loop |
| Gene Family | MIPF0000156;mir-277 |
| Genome Context | chr3R: 10100022-10100121 [+] |
| miRna Matures Links | |
| Sequence | UUGAAGGUUUUGGGCUGCGUGUCAGGAGUGCAUUUGCACUGAAACUAUCUGAAGCAUGUAAAUGCACUAUCUGGUACGACAUUCCAGAACGUACAAUCUU |